Opis

Joanna Jaworek, jaworek.joanna@gmail.com
Temat: Programowanie z wykorzystaniem ograniczeń CLP. Sekwencjonowanie DNA- projekt z wykorzystaniem biblioteki JPL swi-prolog.

Wstęp

Niniejsza praca składa się z sześciu rozdziałów: programowanie logiczne, programowanie logiczne z ograniczeniami, CHR, problemy NP-trudne, sekwencjonowanie DNA oraz podsumowanie. Celem pierwszych dwóch rozdziałów jest przedstawienie koncepcji programowania w prologu oraz zaprezentowanie kilku zaimplementowanych przykładów. Rozdział trzeci przedstawia ciekawe wykorzystanie programowania CLP/CHR do rozwiązywania problemów NP-trudnych, czyli o dużej złożoności czasowej. Tutaj także zaprezentuję aplikację umożliwiającą testowanie programów. Rozdział czwarty odwołuje się do ostatnich nowinek ze świata nauki, które pokładają dużą nadzieję w sekwencjonowanie DNA właśnie w prologu. Rozdział ten także zawiera moją własną implementację prostego sekwencjonowanie DNA. Ostatni rozdział to podsumowanie referatu oraz przedstawienie innych implementacji platform oraz narzędzi opartych na CLP.

Programowanie logiczne

Teoria

Programowanie logiczne narodziło się na początku lat 70-tych jako rezultat wcześniejszych prac w zakresie automatycznego dowodzenia twierdzeń i sztucznej inteligencji. Jednak dopiero w chwili opracowania języka PROLOG nabrało walorów praktycznej użyteczności. Metoda programowania w języku logiki stała się podstawą opracowanie języka maszynowego oraz języka programowania wiedzy. Podstawową cechą odróżniającą programowanie logiczne od konwencjonalnych technik programowania jest reprezentowanie wiedzy w sposób jawny, niezwiązany ze sposobem jej użycia w celu rozwiązania problemów drogą rozumowania dedukcyjnego. Pojęcie programowania logicznego jest często źle zdefiniowane. Według Roberta Kowalskiego, będącego jednym z głównych twórców teorii programowania logicznego, opiera się ona na dwóch podstawowych założeniach:
* Traktowanie logiki jako języka programowania
* Oddzielenie logiki programu od sterowania

Prolog a programowanie w logice

Język programowania PROLOG będący jednym z najbardziej rozpowszechnionych systemów programowania w języku logiki oparty jest w zasadniczej części na języku klauzul Horna, który stanowi podzbiór języka klauzulowego postaci logiki.

Szereg technologii wykozystywanych jest w Prolog'u w celu ułatwienia programowania w logice. Należą do nich m.in. CLP,CLP(FD),CLP(QR),CHR.

Constraint logic programming -programowanie z ograniczeniami

Teoria

Programowanie logiczne z ograniczeniami (Constraint Logic Programming CLP) stało się w ostatnich latach popularnym sposobem modelowania i rozwiązywania wielu problemów z dziedziny:

  • sztucznej inteligencji
  • problemów kombinatorycznych
  • przetwarzania mowy
  • harmonogramowania
  • przetwarzania języków naturalnych (konstruowanie efektywnych parserów)
  • systemów baz danych (zapewnienie spójności danych)
  • biologii molekularnej (sekwencjonowanie DNA)
  • inżynierii elektronicznej (lokalizacja błędów)
  • projektowania obwodów drukowanych

Jego główną zaletą jest deklaratywność, czyli sformułowanie zadania jest od razu programem rozwiązującym to zadanie. Programowanie to bazuje na modelowaniu zadania jako problemu spełnienia ograniczeń (Constraint Satisfacton Problem CSP). Ograniczenia są zależne od dziedzin zmiennych, których dotyczą. Najpopularniejszą i pierwszą dziedziną zmiennych była skończona dziedzina liczb naturalnych. Innymi dziedzinami są: skończone zbiory, drzewa, rekordy, przedziały rzeczywiste. Najistotniejszą cechą i największą zaleta programowania z ograniczeniami jest ich propagacja .

Propagacja ograniczeń

Propoagacja ograniczeń sprawiła, że ta technika stała się najlepsza metodą dla wielu problemów kombinatorycznych. Zasadą działania propagacji jest usuwanie wartości nie spełniających ograniczeń z domen zmiennych. Języki do programowania z ograniczeniami mają możliwość wyrażania zmiennych z zakresu domen liczb naturalnych (najczęściej stosowane), przedziałów liczb rzeczywistych, zbiorów i innych.
Przykład:

x €{1..5}, y €{1..6}


Gdy na powyższe dwie zmienne wprowadzimy ograniczenie

 x>y+1

, wtedy
propagacja ograniczeń zredukuje powyższe domeny do następujących wartości:

x €{3, 4, 5}, y €{1, 2, 3}


ponieważ wartości {1, 2} z domeny x nie spełniają ograniczenia x>y+1 dla żadnej z wartości z domeny y. Podobnie można rozpatrywać wartości {4, 5, 6} z domeny y. Jednak możemy wprowadzić takie ograniczenie jak x+y=6, które nie usuwa żadnych wartości z domen. Ograniczenia nie są zazwyczaj tak proste ja to przedstawiono, często łączą ze sobą wiele zmiennych, a metody usuwania poszczególnych wartości, zwane algorytmami filtracyjnymi są bardzo złożone. Sama propagacja z ograniczeniami rzadko daje rozwiązanie. Dlatego jest ona zawsze łączona z dystrybucją i poszukiwaniem.

Dystrybucja i poszukiwanie

W większości przypadków propagacja ograniczeń nie prowadzi do rozwiązania (jak to zostało przedstawione w powyższym przykładzie). Dlatego programowanie z ograniczeniami jest ściśle związane z dystrybucją połączoną z poszukiwaniem.
Dystrybucja polega na wprowadzeniu dodatkowego ograniczenia (często jest to przyporządkowanie jednej wartości do zmiennej, a zadaniem dystrybucji jest odpowiednie wybranie zmiennej i wartości). Kiedy to nastąpi sprawdzana jest spójność poprzez propagację ograniczeń i istnieją trzy możliwości:

  • znalezione zostanie rozwiązanie (wszystkie zmienne mają po jednej wartości w swojej domenie)
  • domeny niektórych zmiennych zostaną zawężone, ale jednoznaczne rozwiązanie nie jest wciąż wyznaczone, więc dystrybucja jest dokonywana na kolejnej zmiennej
  • dodatkowe ograniczenie jest niespójne z pozostałymi ograniczeniami, więc proces nawrotu jest dokonywany, a wybrana wartość z domeny wybranej zmiennej jest usuwana

Ten proces jest dokonywany iteracyjnie i jest nazywany poszukiwaniem. Poszukiwanie jest odpowiedzialne za zatrzymanie; po znalezieniu pierwszego rozwiązania lub pewnej liczby rozwiązań lub wszystkich rozwiązań. Poszukiwanie tworzy tzw. drzewo poszukiwań, gdzie każdy węzeł jest stanem zmiennej.

Ograniczenia

Wyróżniamy następujące ograniczenia:

  • arytmetyczne(porównywanie dwóch liczb: ≤, ≥, ≠,=,<,>)
  • logiczne:(#\ Q-zaprzeczenie, P #/\ Q -and, P#/Q -xor, P #\/ Q-or)
  • dziedziny ograniczone- np. liczby całkowite, naturalne, specyfikacja dziedziny poprzez wypisanie wszystkich elementów
  • drzewa i listy

Moduły CLP

Biblioteka CLP pojawiła się w SWI PROLOG od wersji 5.5.4, a od wersji 5.6.7 wprowadzono dodatkowe moduły, które rozszerzają jej funkcjonalność.
Poniżej przedstawię 4 podstawowe moduły:

clpfd (Constraint Programming Language over Finite Domains)

CLPFD jest modułem CLP i bazuje przede wszystkim na dziedzinie liczb całkowitych. Predykaty modułu umożliwiają m.in. określanie relacji/ograniczeń, konwersję wyrażeń do ich wartości liczbowej, tak że rozrastanie się wyrażeń może postępować we wszystkich kierunkach, systematyczne poszukiwanie rozwiązań. Wyrażeniem w module CLP(FD) może być liczba całkowita, zmienna.
Operacje które można wykonywać: dodawanie i odejmowanie wyrażeń, mnożenie, szukanie minimum lub maksimum dwóch wyrażeń, reszta z dzielenia wyrażeń przez siebie, wartość bezwzględna, dzielenie liczb całkowitych. Natomiast ograniczenia wynikające z relacji to, jak już wcześniej opisałam i przedstawiłam w tabelce: ≠ ,=,> , ≥ , < ,≤ .
Przykład
Poniższy przykład przedstawia wykorzystanie ograniczeń i porównywanie wyrażeń przy pomocy modułu CLP(FD).
Zagadka SEND+MORE=MONEY:

:- use_module(library(clpfd)).
 puz([S,E,N,D,M,O,R,Y]) :-
 Vars = [S,E,N,D,M,O,R,Y],
 Vars ins 0..9,
 all_different(Vars),
sum(S,E,N,D,M,O,R,Y).

 sum(S,E,N,D,M,O,R,Y):-
S*1000 + E*100 + N*10 + D +M*1000 + O*100 + R*10 + E #= M*10000 + O*1000 + N*100 + E*10 + Y,
 M #\= 0, S #\= 0.

Na początku inicjalizujemy moduł clpfd, a następnie tworzymy zmienne Vars I określamy, że powinny należeć do zbioru od 0..9. Var ins oznacza, że liczby będą dokładnie z zakresu od 0..9(jednocyfrowe) bez możliwości tworzenia liczb dwucyfrowych. All different(Vars ) zapewnia, że wszystkie zmienne będą różne.

clp_distinct

CLP_distinct jest to biblioteka, która dostarcza nam ograniczenia na zmienne. Określa w jakim przedziale powinny znajdować się zmienne np.

vars_in([X,Y,Z],[1,2,3])


Można także wywołać predykat, który określi, że zmienne powinny być różne: All_distinct(Vars)
Aby otrzymać konkretne wartości, a nie przedziały, wtedy stosujemy predykat label/1.
Przykład:

 [X,Y] in 1..3, vars_in([X, Y],[1, 2]), all_distinct([X, Y]), label([X, Y]).


Kolejny ciekawy predykat to All_different.
Przykład:

?- [X,Y,Z] in 0..1, all_different([X,Y,Z]).

        X = _G180{0..1}
        Y = _G183{0..1}
        Z = _G186{0..1} ;


Jednak w przeciwieństwie do All_distinct, all_different nie wykrywa braku rozwiązania (patrz przykład powyżej). Dopiero po dodaniu predykatu label/1 wynik jest poprawny-false.

CLP(Q,R) Constraint Logic Programming over Rationals or Reals

CLP(Q,R) Constraint Logic Programming over Rationals or Reals jest to kolejny moduł, który ułatwia programowanie z ograniczeniami. Służy on do modelowania problemów na zbiorze liczb rzeczywistych i wymiernych. Biblioteka CLP(Q,R) składa się z dwóch modułów:

  • CLP(Q)-dla liczb wymiernych:
use_module(library(clpq))
  • CLP(R)-dla liczb rzeczywistych:
use_module(library(clpr))

Większość predykatów dla modułu CLP(Q) oraz CLP(R) są takie same i należą do nich:

Predykaty Opis
+ Expr unary plus
- Expr unary minus
Expr + Expr addition
Expr - Expr subtraction
Expr * Expr multiplication
Expr / Expr division
abs(Expr) absolute value
sin(Expr) trigonometric sine
cos(Expr) trigonometric cosine
tan(Expr) trigonometric tangent
pow(Expr,Expr) raise to the power
exp(Expr,Expr) raise to the power
min(Expr,Expr) minimum of the two arguments
max(Expr,Expr) maximum of the two arguments

Ograniczenia:

Ograniczenia Opis
Expr =:= Expr equation
Expr = Expr equation
Expr < Expr strict inequation
Expr > Expr strict inequation
Expr =< Expr nonstrict inequation
Expr >= Expr nonstrict inequation
Expr =\= Expr disequation

Wyjątek pomiędzy bibliotekami stanowi predykat: bb_inf/4 w CLP(Q) i bb_inf/5 w CLP(R).Predykaty te obliczają kres dolny wyrażenia. Różnią się jedynie tym, że dla liczb rzeczywistych określamy jeszcze zakres dla którego liczba będzie zaokrąglana do liczby całkowitej.

Używanie dwóch bibliotek jest dozwolone w jednym programie, jednak trzeba je zadeklarować oddzielnie. Błędy w działaniu programu pojawiają się, gdy dla tych samych zmiennych stosujemy predykaty z różnych bibliotek.

Wady CLP

Biblioteka CLP pomimo swojej złożoności i wielu dodatkowych modułów z których programiści mogą korzystać często nie wystarcza by szybko i wydajnie rozwiązywać złożone problemy.
W celu zmodyfikowania istniejących ograniczeń lub stworzenia nowych, dokładniejszych reguł został stworzony specjalny język programowania CHR (z ang. Constraint Handling Rules), który umożliwia szybsze tworzenie programów i ich optymalizację.

CHR -Constraint Handling Rules

CHR jest deklaratywnym językiem programowania, który został stworzony przez Thom Frühwirth w 1991 roku. Jest używany jako język wysokiego poziomu do rozwiązywania takich problemów jak:

  • weryfikacja danych
  • rozumowanie abdukcyjne
  • systemy wieloagentowe
  • analiza języka naturalnego , czy kompilacji.

Język Constraint Handling Rules jest zaimplementowany w SWI-Prologu i dostępny od wersji 5.6.0.

Dołączenie biblioteki następuje poprzez:

:- use_module(library(chr)).


Przykład:
Ponizszy przykład przedstawia zasadę działania CHR. Pokazuje w jaki sposób określić znak nierówności ≤ (http://www.sics.se/sicstus/docs/3.7.1/html/sicstus_34.html#SEC290):

:- use_module(library(chr)).

handler leq.
constraints leq/2.
:- op(500, xfx, leq).

reflexivity  @ X leq Y <=> X=Y | true.
antisymmetry @ X leq Y , Y leq X <=> X=Y.
idempotence  @ X leq Y \ X leq Y <=> true.
transitivity @ X leq Y , Y leq Z ==> X leq Z.

Jak widzimy reguła składa się z 4 części : zwrotności, antysymetrii, idempotentności i przechodniości. Ich nazwy poprzedzają znak @, a po nich występują predykaty zdefiniowane przez użytkownika (heads), wbudowane (guards) lub oba rodzaje ograniczeń (body), definiujące własności relacji.

Ciekawy jest sposób wywołania funkcji:

?- leq(X,Y), leq(Y,Z). 

Jako wynik działania otrzymujemy Yes, co oznacza, że dla X≤Y, Y≤Z to X≤Z.

Program z przykładami

Implementacja

Projekt został napisany w Javie z wykorzystaniem SWI Prolog’u. Funkcje, które realizuje aplikacja to:
* Obliczanie wartości silni

  • Obliczanie n-tego wyrazu ciągu Fibonacciego
  • Obliczanie pierwiastków równania kwadratowego
  • Obliczanie kolorów dla 6 zdefiniowanych państw
  • Problem plecakowy
  • Problem n-królowej

Interfejs użytkownika

Interfejs użytkownika został stworzony przy pomocy biblioteki SWING.

Wynik działania dla problemu plecakowego:

Sekwencjonowanie DNA

Teoria

Sekwencjonowanie DNA to procedura w której odczytuje się dokładną kolejność zasad (A, C, T i G) tworzących cząsteczkę DNA.
Przykład sekwencji DNA (początek operonu laktozowege E. coli):

 <code> GACACCATCGAATGGCGCAAAACCTTTCGCGGTATGGCATGATAGCGCCCGGAAGAGAGTCAATTCAGGG</code>\\

Poniższy rysunek przedstawia etapy sekwencjonowanie DNA.

Źródło:http://www.scq.ubc.ca/genome-projects-uncovering-the-blueprints-of-biology/

Obecnie metoda odczytu została zautomatyzowana dzięki wykorzystaniu znakowanych fluorescencyjnie trifosforanów dideoksynukleotydów i pozwala na odczyt 300-1000 par zasad z jednej kapilary lub linii na żelu.
Autorem alternatywnej metody sekwencjonowania DNA, z wykorzystaniem specyficznej, chemicznej degradacji DNA, byli Walter Gilbert i Allan Maxam (metoda Maxama-Gilberta). Gilbert wraz z Frederickiem Sangerem otrzymali za to osiągnięcie nagrodę Nobla. Metoda Maxama-Gilberta obecnie jest rzadko stosowana.
Nowoczesne masowo równoległe aparaty do sekwencjonowania DNA są w stanie pracować z szybkością rzędu milionów par zasad na godzinę. Tranzystory polowe DNA umożliwiają użycie natywnego DNA w hybrydyzacji do mikromacierzy i odczyt w czasie rzeczywistym.

Diagnostyka genetyczna jest prężnie rozwijającą się dziedziną, wykorzystującą najnowsze osiągnięcia technologiczne, naukowe, informatyczne i medyczne. Dzięki postępowi który dokonał się w ostatnich latach możliwe jest przeprowadzenie badań i uzyskanie istotnych informacji medycznych wyprzedzających kliniczne pojawienie się schorzenia. Jest to bardzo istotny aspekt dla zdrowia pacjenta. Dzięki niemu może jeszcze przed pojawieniem się choroby- najczęściej śmiertelnej- jej zapobiec. Mając do dyspozycji narzędzie w postaci testów genetycznych można z dużym prawdopodobieństwem określić ryzyko zachorowania, uzupełnić i potwierdzić obecność dziedzicznego obciążenia genetycznego, a przede wszystkim rozpocząć odpowiednią terapię lub po prostu częściej przeprowadzać badania kontrolne.
Obecnie podczas testowania genetycznego możemy wykryć mutacje/zmiany powodujące takie choroby jak na przykład: • czerniak złośliwy
• rak piersi
• rak prostaty
• choroby nowotworowe
• HPV
• Rak tarczycy
• Mukowiscydoza
• Alzheimer

Implementacja sekwencjonowania DNA w PROLOGu

Wybór środowiska

Projekt został napisany w Javie z wykorzystaniem SWI Prolog’u.
Funkcje, które realizuje aplikacja to:
• Tworzenie komplementarnej nici DNA
• Porównywanie dwóch nici - czy są komplementarne
• Sprawdzanie, czy w sekwencji DNA znajduje się odpowiednia/dowolna sekwencja
• Próba rozpoznawania mukowiscydozy
• Rozpoznawanie guzowatości korzenia na podstawie sekwencji DNA
• Rozpoznawanie błędów addycji/delecji/inwersji

Rozpoznawanie guzowatości korzenia na podstawie sekwencji DNA
Rozpoznanie guzowatości korzenia( crown Gall tumor) następuje poprzez znalezienie sekwencji „TATA box”. TATA box jest to sekwencja w której znajdują się tylko zasady azotowe takie jak: adenina (A) oraz tymina (T).
TATA Box może mieć postać: TATA. TAATA, AATAATa,AATATA,ATATA

Rozpoznawanie mutacji segmentowych -błędów addycji/delecji/inwersji

Do mutacji segmentowych/punktowych zaliczamy- addycję, delecję oraz inwersję. Wszystkie z tych zmian charakteryzują się najczęściej występowaniem tych samych zasad azotowych obok siebie. Mutacje punktowe mogą powodować takie choroby jak: albinizm, anemię sierpowatą czy hemofilię.

Źródłow: Wykłady MSIB AGH
Porównywanie dwóch nici - czy są komplementarne
Brak komplementarności nici powoduje mutacje np. nowotworowe i powoduje niewłaściwe kodowanie białek.
Próba rozpoznawania mukowiscydozy
Powodem mukowiscydozy jest mutacja odcinka genomu CFTR. Odcinek zmutowany nazywamy: ∆F508.
Źródło: http://genome.gsc.riken.go.jp/hgmis/posters/chromosome/cftr.html

Interfejs użytkownika

Wybór środowiska
Projekt napisany w języku JAVA, przy użyciu biblioteki graficznej Swing zintegrowany z SWI Prolog. Program charakteryzuje się modułową budową, umożliwiającą dodawanie funkcjonalości (na przykład nowych sposobów ekstrakcji cech).
Interfejs użytkownika
Interfejs użytkownika powstał dzięki wykorzystaniu biblioteki Java Swing. Interfejs użytkownika składa się z siedmiu paneli i pozwala na intuicyjne poruszanie się między nimi.

Po uruchomieniu aplikacji mamy możliwość zapoznania się z możliwościami aplikacji:
Przykład dla nici komplementarnej:

Przykład dla rozpoznawania sekwencji mukowiscydozy:

Podsumowanie

Prolog wykorzystuje szereg technologii w celu optymalnego rozwiązywania skomplikowanych problemów. Programista może skorzystać z CLP, CHR ale także z clpfd, clp_distinct, czy modułu Simplex. Pomimo tego, że Prolog został stworzony w 1971 roku nadal prężnie się rozwija i rozszerza moduły. Prolog jest zaawansowanym a zarazem prostym językiem programowania. Umożliwia pisanie długich skomplikowanych programów w dosłownie kilku linijkach.
Zastosowanie Prolog’a :

• Inteligentne Systemy - programy, które wykonują przydatne zadania przez używanie technik sztucznej inteligencji.

• Systemy ekspertowe - inteligentne systemy, które potrafią podejmować decyzje na poziomie ludzkiego eksperta.

• Naturalne systemy językowe - które mogą analizować i odpowiadać na zadane pytania w formie zrozumiałej dla człowieka

• Systemy relacyjnej bazy danych

Ciekawe gotowe produkty:

• “Expert System for Selecting Chemical Processing Agitators” (AstraZeneca) – system ekspertowy pomocny chemikom przy mieszaniu różnych substancji

• „Tax Assistant” (VerTec Solutions) – asystent podatkowy

• Intelligent Testing (Pacific AI) – narzędzie do treningu i testowania wiedzy (np. studenta)

• Virtual Pal - First Seamless Natural Language Self-Help (APIIT ) – Ekspert pomagający na stronie WWW

• Breast Cancer Decision Guide – Internetowy doradca w sprawach raka piersi

• Configuration Advice (Xircom Inc.) – Doradca w sprawach konfiguracji sprzętu komputerowego

• FleetPlan – system ekspercki dla sieci lotniczych, który ostatecznie ma „zwiększyć” zyski firmy lotniczej

• PDC-Booking - system skutecznego zarządzania zasobami całego szpitala (wykorzystanie personelu, sprzętu, pokojów,etc.)

Źródła

Dokumentacja

Źródła kodów

  1. Źródło dla aplikacji -przykłady

prolog.rar

  1. Źródło dla aplikacji -sekwencjonowanie DNA

sekwencjonowanie.rar

pl/miw/2009/piw09_clp.txt · ostatnio zmienione: 2017/07/17 08:08 (edycja zewnętrzna)
www.chimeric.de Valid CSS Driven by DokuWiki do yourself a favour and use a real browser - get firefox!! Recent changes RSS feed Valid XHTML 1.0